pGADT7 yeast two-hybrid plasmid


Cat: MOFY-0123-FY19
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number

Size:
 Inquiry
  • Specifications
  • Plasmid Information

Specifications

Species SourceYeast
Size3 µg
CompositionPromoter: ADH1;
Replicon: 2μ ori,ori;
Plasmid classification: yeast series, yeast two-hybrid vector;
Plasmid size: 7987bp;
Prokaryotic resistance: Ampicillin Amp;
Screening marker: LEU2;
Cloned strain: Escherichia coli DH5α;
Culture conditions: 37°C, aerobic LB;
Expression host: yeast cells;
5' sequencing primer: T7: TAATACGACTCACTATAGGG;
3' Sequencing Primers: Design primers based on the sequence.
BufferRefer to COA

Plasmid Information

Product OverviewpGADT7 AD is a yeast expression vector that is designed to express a protein of interestfused to a GAL4 activation domain (AD; amino acids 768-881). Transcription of the GAL4 AD fusion is driven by the constitutively active ADH1 promoter (PADH1), and is terminated at the ADH1 transcription termination signal (TADH1). The GAL4 AD fusion contains an N-terminal SV40 nuclear localization signal (SV40 NLS; 1) that targets the protein to the yeast nucleus,and a hemagglutinin epitope tag (HA Tag), located between the GAL4 AD and the proteinof interest, that allows the protein to be easily detected with HA-tag antibodies.
Regulatory StatusFor Research Use Only
ShippingDry ice
StorageStore at -20 °C.
References1. Zhao, S., Guan, G., Liu, J., Liu, A., Li, Y., Yin, H., & Luo, J. (2017). Screening and identification of host proteins interacting with Theileria annulata cysteine proteinase (TaCP) by yeast-two-hybrid system. Parasites & vectors, 10(1), 1-9.
2. Yu, D., Liao, L., Zhang, J., Zhang, Y., Xu, K., Liu, K., ... & Li, C. (2018). A novel, easy and rapid method for constructing yeast two-hybrid vectors using in-fusion technology. Biotechniques, 64(4), 219-224.
For Research Use Only | Not For Clinical Use.
Online Inquiry