pGEX-TagRFP E. coli fluorescent plasmid
Cat: MOFY-0123-FY46
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Size: | |
Inquiry |
- Specifications
- Plasmid Information
Specifications
Species Source | E. coli |
Size | 2 µg |
Composition | Promoter: Tac/lac promoter; Replicon: ColE1 ori; Plasmid classification: Escherichia coli vector, pGEX series expression plasmid; Plasmid tags: N-GST, C-TagRFP; Prokaryotic resistance: Ampicillin Amp; Cloned strain: Escherichia coli DH5α; Culture conditions: 37°C, aerobic, LB; Expression host: Escherichia coli; Culture conditions: 37°C, aerobic, LB; Induction method: IPTG or lactose and its analogues; 5' sequencing primer: pGEX5: GGGCTGGCAAGCCACGTTTGGTG; 3' sequencing primer: pGEX3: CCGGGAGCTGCATGTGTCAGAGG. Notes: GST affinity column can be used to purify recombinant protein. |
Buffer | Refer to COA |
Plasmid Information
Regulatory Status | For Research Use Only |
Shipping | Dry ice |
Storage | Store at -20 °C. |
For Research Use Only | Not For Clinical Use.
Online Inquiry