pGEX-TagRFP E. coli fluorescent plasmid


Cat: MOFY-0123-FY46
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number

Size:
 Inquiry
  • Specifications
  • Plasmid Information

Specifications

Species SourceE. coli
Size2 µg
CompositionPromoter: Tac/lac promoter;
Replicon: ColE1 ori;
Plasmid classification: Escherichia coli vector, pGEX series expression plasmid;
Plasmid tags: N-GST, C-TagRFP;
Prokaryotic resistance: Ampicillin Amp;
Cloned strain: Escherichia coli DH5α;
Culture conditions: 37°C, aerobic, LB;
Expression host: Escherichia coli;
Culture conditions: 37°C, aerobic, LB;
Induction method: IPTG or lactose and its analogues;
5' sequencing primer: pGEX5: GGGCTGGCAAGCCACGTTTGGTG;
3' sequencing primer: pGEX3: CCGGGAGCTGCATGTGTCAGAGG.
Notes: GST affinity column can be used to purify recombinant protein.
BufferRefer to COA

Plasmid Information

Regulatory StatusFor Research Use Only
ShippingDry ice
StorageStore at -20 °C.
For Research Use Only | Not For Clinical Use.
Online Inquiry