- Home
- Products
- pRSETB E. coli expression plasmid
pRSETB E. coli expression plasmid
Cat: MOFY-0123-FY72
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
| Size: | |
| Inquiry |
- Specifications
- Plasmid Information
Specifications
| Species Source | E. coli |
| Size | 2 µg |
| Composition | Promoter: T7/lac; Replicon: pUC ori, F1 ori; Terminator: T7 terminator; Plasmid classification: Escherichia coli vector, pRSET series expression plasmid; Plasmid size: 2887bp; Plasmid tags: N-His, N-EK, N-Xpress; Prokaryotic resistance: Ampicillin Amp; Cloned strain: DH5α; Culture conditions: 37°C, aerobic, LB; Expression host: BL21(DE3) series, BL21Star(DE3) is recommended; Culture conditions: 37°C, aerobic, LB; Induction method: IPTG or lactose and its analogues; 5' sequencing primer: T7: TAATACGACTCACTATAGGG; 3' sequencing primer: T7-ter: TGCTAGTTATTGCTCAGCGG; Notes: pRSET expression plasmid. |
| Buffer | Refer to COA |
Plasmid Information
| Product Overview | The pRSET B vector is derived from the pUC vector. The purpose of the vector design is to express and purify the cloned gene at a high level in E. coli. The T7 promoter on the vector makes it possible to express the cloned gene sequence at a high level from the pRSETB vector. In addition, the DNA insert is located on the downstream side of the vector and is in-frame with the upstream protein coding sequence expressing an N-terminal fused peptide. The sequence includes an ATG translation initiation codon, a 6X His tag, a transcriptional stabilization sequence derived from bacteriophage T7 gene 10, an XPress epitope, and an enterokinase cleavage recognition sequence. His tag allows for simple Ni column protein purification. The enterokinase recognition site is located between the His tag and the recombinant protein, and the N-terminal fusion peptide of the recombinant protein can be conveniently removed subsequently. |
| Regulatory Status | For Research Use Only |
| Shipping | Dry ice |
| Storage | Store at -20 °C. |
| References | Chiang, C. L., Sung, C. S., Wu, T. F., Chen, C. Y., & Hsu, C. Y. (2005). Application of superparamagnetic nanoparticles in purification of plasmid DNA from bacterial cells. Journal of Chromatography B, 822(1-2), 54-60. |
For Research Use Only | Not For Clinical Use.
Online Inquiry